This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGTCCAAGAGCGTATGTGG and AGGGGTCCTAGTGAATGATG, which resulted in a 422 bp deletion beginning at Chromosome 19 position 4,219,999 bp and ending after 4,220,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001213380 (exon 2) and 255 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 11 amino acids later.