This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGGAGCCTGCTAGAAAG and CTATCTCAACTGGTGCCTCA, which resulted in a 268 bp deletion beginning at Chromosome 2 position 167,048,375 bp and ending after 167,048,642 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511240 (exon 5) and 119 bp of flanking intronic sequence including the splice acceptor and donor.