This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGTTATCACATTATCCAA and GTTACACAAGAACTGCTGTT, which resulted in a 189 bp deletion beginning at Chromosome 9 position 95,493,667 bp and ending after 95,493,855 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219474 (exon 5) and 74 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 38 amino acids later.