This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTTGAGATTGCAGTTTGCC and CCTCTTTTTCGACTTGGTTT, which resulted in a 212 bp deletion beginning at Chromosome 12 position 84,459,515 bp and ending after 84,459,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000753116 (exon 4) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 9 amino acids later.