This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAACAATAGGAAGCTCCCA and GAGGTGTGTAAGGTGATCCA, which resulted in a 348 bp deletion beginning at Chromosome 8 position 111,841,722 bp and ending after 111,842,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214932 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation at amino acid 61.