This allele from project TCPR1318 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTACATCTGGCATACTGAG and ATTAGGATTTCCCAACAGTC targeting the 5' side and AATGGGGCTAGCTTACTTCC and CCTCATGACAAGTGAAATCA targeting the 3' side of a critical exon(s). This resulted in a 1155-bp deletion on Chr15 from 33249824 to 33250978 (GRCm38).