This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGGTGTGACATTACAAG and TACAAATAGCTATTACTACA, which resulted in a 1929 bp deletion beginning at Chromosome 5 position 53,276,856 bp and ending after 53,278,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254968 and ENSMUSE00000766691 (exons 2 and 3) and 1228 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 2 amino acids later. There is a 2 bp TG insertion at the deletion site. RT-qPCR analysis demonstrated the absence of Smim20 mRNA expression in the hypothalamus of homozygous mutant females.