This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGTGAGTCTACAGTTTGG and ACTCGGCTTCAATAGATACT, which resulted in a 641 bp deletion beginning at Chromosome 10 position 89,772,175 bp and ending after 89,772,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000574231 (exon 4) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 82.