This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCATCCCTTAAAGGTCATG and AGAAGGCTCTGGTTCATGTT, which resulted in a 800 bp deletion beginning at Chromosome 1 position 38,018,772 bp and ending after 38,019,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340970 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 75 amino acids later.