This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCTCCTCCCCTGTCCGCG and TTTTGGATCAGACCAACTCG, which resulted in a 3280 bp deletion beginning at Chromosome 16 position 30,599,668 bp and ending after 30,602,947 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343942 (exon 1) and 205 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted to generate a null allele.