This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACAGGCAACGTCAAACTGG and GGAGGCGCAGGCTGTGCCCG, which resulted in a 453 bp deletion beginning at Chromosome 3 position 54,807,204 bp and ending after 54,807,656 bp (GRCm38/mm10). This mutation deletes 453 bp of ENSMUSE00000389769 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6, delete 151 amino acids then return into frame for the remaining 74 amino acids and stop codon.