This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAAAGGGCTATCCTCCGTG and CAGAAGTTGCACTTGTGTTA, which resulted in a 1360 bp deletion beginning at Chromosome 3 position 98,427,181 bp and ending after 98,428,540 bp (GRCm38/mm10). This mutation deletes 1360 bp from ENSMUSE00000467437 (exon 3) and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 44 amino acids later.