CRISPR/Cas9 technology targeted the first exon (guide RNA sequences: GCCGCAGCATTCGCCGTGAA+CGG) and generated a 38 bp deletion (CGTAGGAGAGCCCGTTCACGGCGAATGCTGCGGCCGCC) resulting in a frame shift that is expected to produce a truncated protein with 33 amino acids. Expression of the mRNA is only about 10% of that of wild-type and Western blot analysis confirmed absence of protein in livers due to nonsense-mediated decay of mRNA.