This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGGGGAATAGATTATAG and AGTTATCGTTTTTCACGCAG, which resulted in a 615 bp deletion beginning at Chromosome 1 position 54,550,691 bp and ending after 54,551,305 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602220 (exon 2) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 69 amino acids later.