This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATCCCTTCAACCACCCAG and AGAAGTACAAGTCAGAGGCG, which resulted in a 659 bp deletion beginning at Chromosome 4 position 43,968,272 bp and ending after 43,968,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000179593 (exon 3) and 555 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 5 amino acids later.