This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGTATATTGACAGCTGTC and TTTACAGGCTATTAGAGAGG, which resulted in a 604 bp deletion beginning at Chromosome 12 position 104,266,357 bp and ending after 104,266,960 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001020941 (exon 4) and 330 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 202 and early truncation 2 amino acids later.