This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCCTGAGAGTTTCCCAAG and TTTGATGTAAAACATGAAAG, which resulted in a 332 bp deletion beginning at Chromosome 6 position 85,461,376 bp and ending after 85,461,707 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000194312 (exon 5) and 279 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 131 and early truncation 31 amino acids later.