This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATTGATACACATATAGAT and TCCACCCAACCCTTAACACA, which resulted in a 2230 bp deletion beginning at Chromosome 14 position 87,485,304 bp and ending after 87,487,533 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122962-ENSMUSE00000122958 (exons 8-10) and 1806 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 239 and early truncation 23 amino acids later.