This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCTCTGCCCCAAGGTTG and CTAGATTCTGGACAAGTCCA, which resulted in a 431 bp deletion beginning at Chromosome 6 position 30,613,766 bp and ending after 30,614,196 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000372503 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 15 amino acids later.