This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACACCATAGCAACTGCACAA and GATGGATTCTCCATGCTAAA, which resulted in a 1677 bp deletion beginning at Chromosome 6 position 136,400,277 bp and ending after 136,401,953 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001369384 (exon 2) and 107 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele.