This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGCAGTGCGGTGGCCAC and CATCATGCCCCCAGGCCCCG, which resulted in a 1340 bp deletion beginning at Chromosome 9 position 65,390,300 bp and ending after 65,391,639 bp (GRCm38/mm10). This mutation deletes 1340 bp from ENSMUSE00000424249 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 11 amino acids later.