This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCTGTGATTATCTGGTGT and TTTATGACAGCCTCATATGC, which resulted in a 137 bp deletion beginning at Chromosome 10 position 51,481,213 bp and ending after 51,481,349 bp (GRCm38/mm10). This mutation deletes 137 bp from ENSMUSE00001008219 (exon 3) and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later.