This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTGTTCTTCAGACCTAG and CACATTGCGCAATCAATGGG, which resulted in a 1179 bp deletion beginning at Chromosome 7 position 45,408,776 bp and ending after 45,409,954 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519385 (exon 2) and 360 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 218 and early truncation 60 amino acids later.