This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTTCCAGATCGCCCA and AATGGGGTGGTAGAGCCCCT, which resulted in a 660 bp deletion beginning at Chromosome 13 position 54,467,578 bp and ending after 54,468,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001223112 (exon 2) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 23 amino acids later.