This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACGACACACCAATAAGCGT and AGGCTCATTACATTGGGAGA, which resulted in a 7358 bp deletion beginning at Chromosome 3 position 95,624,895 bp and ending after 95,632,252 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001346731, ENSMUSE00000251943, and ENSMUSE00000492954 (exons 1, 2 and 3) and 3436 bp of flanking intronic sequence including the splice acceptor and donor and start site. This allele is predicted to generate a null allele. There is a 9 bp AGAAAGCAG insertion at the deletion site.