This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGCACTCACGTTTGTTTTG and GACTATATATGAGTTATGAT, which resulted in a 5805 bp deletion beginning at Chromosome 3 position 93,443,307 bp and ending after 93,449,111 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000427035 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 24 amino acids later. There is a 2 bp insertion (AG) at the deletion site.