This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAAAAAGCCCGTCCTGTT and GTATCCCCTAAATGAGCTTT, which resulted in a 559 bp deletion beginning at Chromosome 16 position 32,256,492 bp and ending after 32,257,050 bp (GRCm38/mm10). This mutation deletes 559 bp from ENSMUSE00000130400 (exon 3) and is predicted to cause a change of amino acid sequence after residue 171 and early truncation 12 amino acids later.