This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTGGATACAGAGCAGCGA and TCTCTCTAACAAATTCCAGG, which resulted in a 1953 bp deletion beginning at Chromosome 9 position 106,500,324 bp and ending after 106,502,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000583343 and ENSMUSE00000530264 (exons 2 and 3) and 1410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 3 amino acids later.