This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGGGATCCTGCAATTTAAG and GCTACCGATTTCCCTTCCCG, which resulted in a 1972 bp deletion beginning at Chromosome 1 position 34,471,279 bp and ending after 34,473,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000966996, ENSMUSE00001013859, ENSMUSE00000972361, ENSMUSE00000972732, and ENSMUSE00001085919 (exons 9-13) and 1442 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 230 and early truncation 9 amino acids later. There is a 12 bp (GCACCCATTGCA) insertion at the deletion site.