This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGCACTGTTGCTTTCAC and GCTGTACCCATAGCCCAGAT, which resulted in a 4024 bp deletion beginning at Chromosome 8 position 105,289,880 bp and ending after 105,293,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411822, ENSMUSE00000371260, ENSMUSE00000382733, ENSMUSE00000363245, ENSMUSE00000333253, ENSMUSE00000333141, ENSMUSE00000344357, ENSMUSE00000389567, ENSMUSE00000365886, and ENSMUSE00000354408 (exons 5-14) and 2197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early truncation 42 amino acids later.