This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA, which resulted in a 1135 bp deletion beginning at Chromosome 6 position 128,980,911 bp and ending after 128,982,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967171 and ENSMUSE00001067493 (exons 5 and 6) and 849 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 12 amino acids later. There is a 9 base pair insertion (ACAATGCAC) at the deletion site.