This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCCGAGGATACTGCACAG and TTCCCCAGAGATACCCACCA, which resulted in a 711 bp deletion beginning at Chromosome 7 position 138,989,077 bp and ending after 138,989,787 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000452940 (exon 2) and 468 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele.