This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCACTCAGTGATAATGAA and TGATGTGCATTACACCCTGG, which resulted in a 2287 bp deletion beginning at Chromosome 7 position 118,647,495 bp and ending after 118,649,781 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000408830, ENSMUSE00000351147 (exons 6,7) and 1986 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 298 and early truncation 1 amino acid later.