This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGTTGGTTGACTAAGGGGA and GAGCTGAGAACTCAACAAAA, which resulted in a 441 bp deletion beginning at Chromosome 9 position 28,813,224 bp and ending after 28,813,664 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000537413 (exon 6) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 213 and early truncation 1 amino acids later.