This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTGGAGGGGTCTTCGTCT and CAGCACGCTGCAGACACCAG, which resulted in a 107 bp deletion beginning at Chromosome 18 position 65,758,287 bp and ending after 65,758,393 bp (GRCm39/mm39). This mutation deletes 107 bp of ENSMUSE00001378438 (exon 3) and is predicted to cause a change of amino acid sequence after residue 740 and early truncation 13 amino acids later.