This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACTGTATGACTCACAGAC and TTATGAAACCACACAGGCCC, which resulted in a 325 bp deletion beginning at Chromosome 4 position 91,169,372 bp and ending after 91,169,696 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001307484 (exon 3) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 61 amino acids later.