This allele from project TCPR1188 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGTGCTTTGGAGTTCCTTCAGC targeting the 5' side and GGTCGGAGAGGTTAAGCACTGTT targeting the 3' side leading to a 1000-bp deletion from Chr17: 71455530 to 71456529 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.