This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTGAATCAGTTAGGAGA and CCATGTGCTTGTCTACGGAG, which resulted in a 7630 bp deletion beginning at Chromosome 7 position 24,531,163 bp and ending after 24,538,792 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000404079 and ENSMUSE00000317876 (exons 2 and 3) and 1763 bp of intronic sequence including the splice acceptor and donor the start site and 3â UTR and is predicted to result in a null allele.