This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGATCATGGCCAAAGGA and GCGTATATATGATTTTTAGA, which resulted in a 510 bp deletion beginning at Chromosome 18 position 12,817,618 bp and ending after 12,818,127 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244258 (exon 2) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 2 amino acids later.