This was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGCAGCCAAAGAACCAGG and CCCCACAGTCTAATATGAAA, which resulted in a 414 bp deletion beginning at Chromosome X position 7,903,461 bp and ending after 7,903,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000206943 (exon 3) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 34 amino acids later.