This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTTCCTGGGGTACTACT and TGACGTGGAGAAACTTTCAG, which resulted in a 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001228555, ENSMUSE00001229512, and ENSMUSE00001247942 (exons 3,4, and 5) and 2282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 2 amino acids later.