This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCGTCTGACGTTCCCCA and AGACCTTGAACAAATGACAT, which resulted in a 463 bp deletion beginning at Chromosome 12 position 8,373,662 bp and ending after 8,374,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000106987 (exon 4) and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 135 and early truncation 12 amino acids later.