This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTGTTGACGGTTGGTAA and ATAGCAATAGCTGAAGACCA, which resulted in a 319 bp deletion beginning at Chromosome 14 position 55,741,126 bp and ending after 55,741,444 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300021 (exon 5) and 186 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 32 amino acids later.