This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGACCACGGCGGC and GCAGATGTCTTTGCACTGTC, which resulted in a 2611 bp deletion beginning at Chromosome 8 position 125,669,882 bp and ending after 125,672,492 bp (GRCm38/mm10). This mutation deletes 2611 bp of ENSMUSE00000346397 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 5 amino acids later.