This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGTGGCGCTGACTTAACAT targeting the 5' side and TGGTTGCATGAAGCCGCAGC targeting the 3' side flanking the CDS (ENSMUSE00000679346 & ENSMUSE00000639006). This resulted in a 7,713-bp deletion of Chr2 from 168,104,267 to 168,111,979 (GRCm39) introducing a frameshift and premature stop codon.