This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACACTGATGTCACGTGAC and ACGAGGCTCCACTAAATATG, which resulted in a 439 bp deletion beginning at Chromosome 10 position 100,594,971 bp and ending after 100,595,409 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000268647 (exon 3) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 21 amino acids later.