Arginine codon 63 (CGT) in exon 4 was changed to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with sialic acid metabolism disorder leading to cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss. Transcripts are expressed from this allele but not proteins.