Glycine codon 44 (GGA) in exon 3 was changed to glutamic acid (GAA) (c.131G>A:p.G44E) using an sgRNA (targeting GGAGAGACGAGGATCATCAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, at the C-terminal edge of the signal peptide sequence of the encoded peptide, is the equivalent of the human c.149G>A (p.G50E) mutation associated with autosomal-dominant cornification disorder characterized by abnormal skin desquamation. The mutation interferes with signal peptide cleavage, leading to mislocalization of the protein.