This allele from project BC052040-7395J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAACATGTGCACACAG, GGTCATGCAGTGACAAGGAA, CTACTCTAGATAGGCCCCTT, and TAAACCTGAGCTAAACCTAA, which resulted in a 195 bp deletion spanning exon 4 beginning at Chromosome 2 positive strand position 115,638,917 bp, GGAGAAACATGTGCACACAGG, and ending after AACCTGAGCTAAACCTAAGG at 115,639,111 bp (GRCm38/mm10). This mutation deletes exon 4 and 134 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 71 and early truncation 6 amino acids later.