This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGGTGCACAGCATGCCG and AACAGTGTCAGGCACTGCGG, which resulted in a 1299 bp deletion beginning at Chromosome 9 position 44,315,851 bp and ending after 44,317,149 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216722-ENSMUSE00000216734 (exons 3-7) and 730 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 22 amino acids later.